A Brief History Of Creation Science And The Search For The Origin Of Life

Author : Bill Mesler
Publisher : W. W. Norton & Company
ISBN 13 : 0393248542
Total Pages : 288 pages
Book Rating : 4.48/5 ( download)

DOWNLOAD NOW!

Download or read book A Brief History of Creation: Science and the Search for the Origin of Life written by Bill Mesler and published by W. W. Norton & Company. This book was released on 2015-12-07 with total page 288 pages. Available in PDF, EPUB and Kindle. Book excerpt: The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? In this essential and illuminating history of Western science, Bill Mesler and H. James Cleaves II seek to answer the most crucial question in science: How did life begin? They trace the trials and triumphs of the iconoclastic scientists who have sought to solve the mystery, from Darwin’s theory of evolution to Crick and Watson’s unveiling of DNA. This fascinating exploration not only examines the origin-of-life question, but also interrogates the very nature of scientific discovery and objectivity.

Author : Adam Rutherford
Publisher : Penguin
ISBN 13 : 1101622628
Total Pages : 288 pages
Book Rating : 4.29/5 ( download)

DOWNLOAD NOW!

Download or read book Creation written by Adam Rutherford and published by Penguin. This book was released on 2013-06-13 with total page 288 pages. Available in PDF, EPUB and Kindle. Book excerpt: What is life? Humans have been asking this question for thou­sands of years. But as technology has advanced and our understanding of biology has deepened, the answer has evolved. For decades, scientists have been exploring the limits of nature by modifying and manipulating DNA, cells and whole organisms to create new ones that could never have existed on their own. In Creation, science writer Adam Rutherford explains how we are now radically exceeding the boundaries of evolution and engineering entirely novel creatures—from goats that produce spider silk in their milk to bacteria that excrete diesel to genetic circuits that identify and destroy cancer cells. As strange as some of these creations may sound, this new, synthetic biology is helping scientists develop radical solutions to some of the world’s most pressing crises—from food shortages to pandemic disease to climate change—and is paving the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? We know that every creature on Earth came from a single cell, sparked into existence four billion years ago. And as we come closer and closer to understanding the ancient root that connects all living things, we may finally be able to achieve a second genesis—the creation of new life where none existed before. Creation takes us on a journey four billion years in the making—from the very first cell to the ground-breaking biological inventions that will shape the future of our planet.

Author : Adam Rutherford
Publisher : Penguin
ISBN 13 : 1617230111
Total Pages : 291 pages
Book Rating : 4.10/5 ( download)

DOWNLOAD NOW!

Download or read book Creation written by Adam Rutherford and published by Penguin. This book was released on 2014-05-27 with total page 291 pages. Available in PDF, EPUB and Kindle. Book excerpt: Today’s scientists are radically exceeding the boundaries of evolution and engineering entirely novel creatures. Cutting edge “synthetic biology” may lead to solutions to some of the world’s most pressing crises and pave the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? As we come closer and closer to understanding the ancient root that connects all living things, Adam Rutherford shows how we may finally be able to achieve the creation of new life where none existed before.

Author : Adam Rutherford
Publisher : Penguin UK
ISBN 13 : 0141970227
Total Pages : 272 pages
Book Rating : 4.26/5 ( download)

DOWNLOAD NOW!

Download or read book Creation written by Adam Rutherford and published by Penguin UK. This book was released on 2013-04-04 with total page 272 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Author : Jim Baggott
Publisher : Oxford University Press
ISBN 13 : 0192561960
Total Pages : 432 pages
Book Rating : 4.61/5 ( download)

DOWNLOAD NOW!

Download or read book Origins written by Jim Baggott and published by Oxford University Press. This book was released on 2018-06-07 with total page 432 pages. Available in PDF, EPUB and Kindle. Book excerpt: What is life? Where do we come from and how did we evolve? What is the universe and how was it formed? What is the nature of the material world? How does it work? How and why do we think? What does it mean to be human? How do we know? There are many different versions of our creation story. This book tells the version according to modern science. It is a unique account, starting at the Big Bang and travelling right up to the emergence of humans as conscious intelligent beings, 13.8 billion years later. Chapter by chapter, it sets out the current state of scientific knowledge: the origins of space and time; energy, mass, and light; galaxies, stars, and our sun; the habitable earth, and complex life itself. Drawing together the physical and biological sciences, Baggott recounts what we currently know of our history, highlighting the questions science has yet to answer.

Author : Robert Shapiro
Publisher :
ISBN 13 :
Total Pages : 332 pages
Book Rating : 4.54/5 ( download)

DOWNLOAD NOW!

Download or read book Origins written by Robert Shapiro and published by . This book was released on 1987 with total page 332 pages. Available in PDF, EPUB and Kindle. Book excerpt:

Author : Bill Nye
Publisher : Macmillan
ISBN 13 : 1250007135
Total Pages : 320 pages
Book Rating : 4.31/5 ( download)

DOWNLOAD NOW!

Download or read book Undeniable written by Bill Nye and published by Macmillan. This book was released on 2014-11-04 with total page 320 pages. Available in PDF, EPUB and Kindle. Book excerpt: From the host of "Bill Nye the Science Guy" comes an impassioned explanation of how the science of our origins is fundamental to our understanding of the nature of science

Author : Fazale Rana
Publisher : NavPress Publishing Group
ISBN 13 : 9781576833445
Total Pages : 0 pages
Book Rating : 4.45/5 ( download)

DOWNLOAD NOW!

Download or read book Origins of Life written by Fazale Rana and published by NavPress Publishing Group. This book was released on 2004 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt: Imagine primordial Earth, a churning cauldron of liquefied rock. Steaming, seething -- a vast desolate wasteland, inhospitable to life. Yet somehow first life appeared. Maybe chemicals in a primordial soup spontaneously spawned a single-celled creature that continued to evolve. Or perhaps a transcendent Creator formed and nurtured the initial life forms. To determine what really happened requires a framework to evaluate the evidence. For the first time in print, Dr. Rana and Dr. Ross present a scientific model for the creation of first life on Earth -- a model based on the Bible. They present testable predictions for this life-origins scenario and for the competing naturalistic scenarios. Which model withstands the rigorous scrutiny of science and the tests of time? The one that does gives insight to a deeper question: Why would the first life forms precede human life by billions of years? Book jacket.

Author : National Academy of Sciences (U.S.)
Publisher : National Academies Press
ISBN 13 : 9780309064064
Total Pages : 48 pages
Book Rating : 4.66/5 ( download)

DOWNLOAD NOW!

Download or read book Science and Creationism written by National Academy of Sciences (U.S.) and published by National Academies Press. This book was released on 1999 with total page 48 pages. Available in PDF, EPUB and Kindle. Book excerpt: This edition of Science and Creationism summarizes key aspects of several of the most important lines of evidence supporting evolution. It describes some of the positions taken by advocates of creation science and presents an analysis of these claims. This document lays out for a broader audience the case against presenting religious concepts in science classes. The document covers the origin of the universe, Earth, and life; evidence supporting biological evolution; and human evolution. (Contains 31 references.) (CCM)

Author : Richard B. Bliss
Publisher :
ISBN 13 : 9780890510537
Total Pages : 51 pages
Book Rating : 4.39/5 ( download)

DOWNLOAD NOW!

Download or read book In Search of the ... Origin of Life written by Richard B. Bliss and published by . This book was released on 1979 with total page 51 pages. Available in PDF, EPUB and Kindle. Book excerpt: A textbook which analyzes two theories of the origin of life and presents arguments supporting each one.